User Tools

Site Tools


Sidebar

This is the sidebar. Without it, the main text is too wide!


2019년 11월 교육 자료

markers.fasta
>ecpE ECP production pilus chaperone 336904:337614 reverse
atgttcaggcgacgtggcgtaacattaactaaggccctgctgacagcggtctgtatgctg
gcggcacctttgacacaggcgatttcggtcggcaatctgactttttcactgccgtccgag
actgactttgtcagcaaacgtgtagtgaataacaacaaaagcgcgcggatataccgtatt
gccatcagtgctatcgatagcccgggcagcagtgaattacgcacccgaccggtggatggt
gaactgcttttcgccccccgccagctggcgttgcaggctggtgagagcgagtattttaaa
ttttactatcatgggccacaggataaccgcgagcgctactaccgggtctcatttcgcgag
gtccccactcgtaacctgacaaaacgcagccctaccggcggtgaggttagcacggagccg
gtggtggtgatggataccattctggtagtacgaccacgtcaggttcagtttaaatggtcc
ttcgatcaggtgaccggaacggtaagtaacaccggcaacacgtggtttaagctactgatt
aaaccaggatgtgattcgaccgaagaggaaggcgatgcctggtatctacgtccggaagac
gtggttcatcagcctgagttacgtcagccggggaatcactatctggtctataacgacaaa
ttcattaagattagcgattcctgtccggctaagcccccttcggcggactga
>ecpD polymerized tip adhesin of ECP fibers 337583:339226 reverse
atgagagttaacctactgatagcgatgataatctttgcgctaatctggccagtaactgcg
ctcagagcggcagtgagcaaaacaacctgggcggatgcaccggcacgcgagtttgtgttt
gtcgaaaacaactcagacgacaactttttcgtcactcctggcggggcgctggatccgcgc
ctgaccggtgccaaccgctggaccggtttaaaatacaatggttcaggaaccatctatcag
caaagcctcggctacattgataacggttacaacaccggcctttataccaactggaagttt
gatatgtggctggaaaattcaccagtttcatctcctttaactggcttgcgctgcatcaac
tggtacgctgggtgtaatatgaccaccagtcttatcctgccgcaaaccaccgacaccagt
ggattttatggcgcgacggtgaccagcggcggcgcgaagtggatgcacggcatgttgtca
gacgcgttttaccagtatctgcaacaaatgcccgtcggcagcagctttacaatgaccatc
aatgcctgccagacctctgtgaactatgacgccagcagcggcgcacgctgtaaggatcag
gcctccggcaactggtatgttcgcaacgtcacccatacgaaagcagcaaatctacggttg
ataaatacccactcgctggcggaagtatttatcaacagcgacggagtaccgactctgggc
gaagggaacgccgactgccggacgcaaaccatcggcagccgttcaggattaagttgtaag
atggttaactataccctgcaaacaaacggactcagcaacacctcaatccatatattcccg
gcgatcgccaactcgtcgttagcctcggccgtcggggcgtacgatatgcagttcagtctg
aatggcagttcatggaaaccggtgagcaatactgcctattactacaccttcaacgagatg
aagagcgcagactcgatctatgttttcttctcgagcaacttctttaagcagatggtgaac
cagggaatcagcgatatcaacaccaaagatctattcaactttcgctttcagaacaccaca
tcaccggagtctggctggtatgaattttctacctccaacacgctgattatcaaaccccgt
gatttcagcatcagtattatctccgatgaatatactcagacaccgtcgcgggagggatat
gtcggcagcggcgagtcggcactcgatttcggctatatcgtaaccaccagcggtaaaaca
gctgccgacgaagtgctgatcaaggtgaccggacccgcgcaggtgattggcgggcgctcc
tattgtgtcttcagctccgatgacggtaaggcgaaagtaccgttcccggcgacgctttcc
tttattacccgcaacggagctacaaaaacctacgatgccgggtgcgatgatagctggcgg
gatatgaccgatgcgctgtggttgaccacaccgtggactgatatctctggcgaagtgggg
cagatggataagaccacagtcaaattttcgattccaatggataacgccatttctctgcgt
acggtagatgataacggctggtttggcgaagtcagcgcttcaggagaaattcatgttcag
gcgacgtggcgtaacattaactaa
>ecpB ECP production pilus chaperone 341767:342435 reverse
atgaaaaagcaccttctgcttctcgctctgctgttatccggaatatctccggcccaggcg
ctggatgtcggcgatatatcatcgtttatgaacagtgacagcagcacgctgagcaaaacg
atcaaaaacagtaccgacagtggtcgccttatcaatatccgtctcgaacggctctcttca
ccgcttgacgacgggcaggttatctcaatggacaagccggacgagttgctactcactccc
gccagcttgctgctacccgcccaagccagcgaagtgatccgcttcttctataagggacca
gcagatgaaaaagagcgctactaccgcattgtctggtttgatcaggccctcagtgatgcg
cagcgcgataatgccaaccgcagcgctgtggccactgcttccgcccgcatcggcaccatt
ctggtcgtcgccccccgccaggcaaactaccactttcagtacgccaacggcaccctgaca
aatacaggaaatgcgacgctgcggatcctcgcctacggcccctgcctgaaagccgccaat
ggtaaagagtgtaaagagaattactacctgatgccgggcaagtcgcgtcgttttacccgc
gtggacacggcggataacaaaggacgggttgcactttggcagggtgataagttcattccc
gtgaaatag
>ecpA ECP pilin 342493:343080 reverse
atgaaaaaaaaggttctggcaatagctctggtaacggtgtttaccggcatgggtgtggcg
caggctgctgacgtaacagctcaggctgtagcgacctggtcagcaacagccaaaaaagac
accaccagtaagctggttgtgacgccactcggtagcctggcgttccagtatgccgaaggc
attaaaggttttaactcacagaaaggtctatttgacgtggctatcgagggtgactcaacg
gctaccgcctttaaactgacctcacgtcttatcaccaacacattaacccagttggatacc
tcaggttccacactgaatgtgggcgtggattataacggcgcggcagtcgaaaaaactggc
gataccgtgatgatcgataccgccaacggcgtactgggcggcaaccttagcccgctggca
aacggttacaatgccagcaatcgtaccaccgcacaggatggtttcactttctccatcatc
agcggcaccaccaatggtaccaccgcagtaaccgattacagcactctaccggaaggcatc
tggagcggcgacgttagcgtacagttcgacgcgacctggaccagttaa
>ecpR transcriptional regulator for the ecp operon 343155:343697 reverse
atggaatgtcaaaaccgttctgataaatacatctggtctccccatgacgcctacttctat
aaaggactatctgaactgattgtggatatcgacagattaatttatctatcgctggagaaa
atcagaaaagatttcgtgtttatcaatctcaatacggattctttaactgaatttataaac
cgtgataatgagtggttatccgcggtaaaggggaaacaggtcgtattgattgcggccaga
aagtcagaagccttagcaaattattggtattacaacagcaatattaggggcgtggtatac
gctggactgagtcgtgatattagaaaagaactggcctatgtgattaatggcaggttcctg
agaaaagatattaagaaagataaaatcactgaccgggaaatggaaattatccgcatgacg
gctcagggaatgctgcctaaatcgattgccagaattgaaaattgtagtgtaaagacagtg
tatacccatcggcgtaatgcagaggccaagctgtactcaaaattatataagttggttcag
taa
>stx2A Shiga toxin 2 subunit A 1267107:1268066 forward
atgaagtgtatattatttaaatgggtactgtgcctgttactgggtttttcttcggtatcc
tattcccgggagtttacgatagacttttcgacccaacaaagttatgtctcttcgttaaat
agtatacggacagagatatcgacccctcttgaacatatatctcaggggaccacatcggtg
tctgttattaaccacaccccaccgggcagttattttgctgtggatatacgagggcttgat
gtctatcaggcgcgttttgaccatcttcgtctgattattgagcaaaataatttatatgtg
gccgggttcgttaatacggcaacaaatactttctaccgtttttcagattttacacatata
tcagtgcccggtgtgacaacggtttccatgacaacggacagcagttataccactctgcaa
cgtgtcgcagcgctggaacgttccggaatgcaaatcagtcgtcactcactggtttcatca
tatctggcgttaatggagttcagtggtaatacaatgaccagagatgcatccagagcagtt
ctgcgttttgtcactgtcacagcagaagccttacgcttcaggcagatacagagagaattt
cgtcaggcactgtctgaaactgctcctgtgtatacgatgacgccgggagacgtggacctc
actctgaactgggggcgaatcagcaatgtgcttccggagtatcggggagaggatggtgtc
agagtggggagaatatcctttaataatatatcagcgatactggggactgtggccgttata
ctgaattgccatcatcagggggcgcgttctgttcgcgccgtgaatgaagagagtcaacca
gaatgtcagataactggcgacaggcctgttataaaaataaacaatacattatgggaaagt
aatacagctgcagcgtttctgaacagaaagtcacagtttttatatacaacgggtaaataa
>stx2B Shiga toxin 2 subunit B 1268078:1268347 forward
atgaagaagatgtttatggcggttttatttgcattagcttctgttaatgcaatggcggcg
gattgtgctaaaggtaaaattgagttttccaagtataatgaggatgacacatttacagtg
aaggttgacgggaaagaatactggaccagtcgctggaatctgcaaccgttactgcaaagt
gctcagttgacaggaatgactgtcacaatcaaatccagtacctgtgaatcaggctccgga
tttgctgaagtgcagtttaataatgactga
>hlyE hemolysin E 1671107:1672018 reverse
atgactgaaatcgttgcagataaaacggtagaggtagttaaaaacgcaatcgaaaccgca
gatggagcattggatctttataataaatatctcgatcaggtcatcccctggcagaccttt
gatgaaaccataaaagagttaagtcgctttaaacaggagtattcacaggcagcctccgtt
ttagttggcaatattaaaaccttactaatggatagccaggataagtattttgaagcaacc
caaacagtgtatgaatggtgtggtgttgcgacgcaattgctcgcagcgtatattttgcta
tttgatgagtataatgagaagaaagcatccgcccagaaagacattctcattaaggtactg
gatgacggcatcacgaagctgaatgaagcgcaaaaatccctgctggtaagctcacaaagt
ttcaacaacgcttccgggaaactgctggcgttagatagccagttaaccaatgatttttca
gaaaaaagcagctatttccagtcacaggtagataaaatcaggaaggaagcgtatgccggt
gccgcagccggtgtcgtcgccggtccatttggtttaatcatttcctattctattgctgcg
ggcgtagttgaagggaaactgattccagaattgaagaacaagttaaaatctgtgcagagt
ttctttaccaccctgtctaacacggttaaacaagcgaataaagatatcgatgccgccaaa
ttgaaattaaccaccgaaatagccgccatcggggagataaaaacggaaactgaaacaacc
agattctatgttgattatgatgatttaatgctttctttgctaaaagaagcggccaataaa
atgattaacacctgtaatgagtatcagaaaagacacggtaagaagacactctttgaggta
cctgaagtctga
>stx1B Shiga toxin 1 subunit B 2924625:2924894 reverse
atgaaaaaaacattattaatagctgcatcgctttcatttttttcagcaagtgcgctggcg
acgcctgattgtgtaactggaaaggtggagtatacaaaatataatgatgacgataccttt
acagttaaagtgggtgataaagaattatttaccaacagatggaatcttcagtctcttctt
ctcagtgcgcaaattacggggatgactgtaaccattaaaactaatgcctgtcataatgga
gggggattcagcgaagttatttttcgttga
>stx1A Shiga toxin 1 subunit A 2924904:2925851 reverse
atgaaaataattatttttagagtgctaacttttttctttgttatcttttcagttaatgtg
gttgcgaaggaatttaccttagacttctcgactgcaaagacgtatgtagattcgctgaat
gtcattcgctctgcaataggtactccattacagactatttcatcaggaggtacgtcttta
ctgatgattgatagtggcacaggggataatttgtttgcagttgatgtcagagggatagat
ccagaggaagggcggtttaataatctacggcttattgttgaacgaaataatttatatgtg
acaggatttgttaacaggacaaataatgttttttatcgctttgctgatttttcacatgtt
acctttccaggtacaacagcggttacattgtctggtgacagtagctataccacgttacag
cgtgttgcagggatcagtcgtacggggatgcagataaatcgccattcgttgactacttct
tatctggatttaatgtcgcatagtggaacctcactgacgcagtctgtggcaagagcgatg
ttacggtttgttactgtgacagctgaagctttacgttttcggcaaatacagaggggattt
cgtacaacactggatgatctcagtgggcgttcttatgtaatgactgctgaagatgttgat
cttacattgaactggggaaggttgagtagtgtcctgcctgattatcatggacaagactct
gttcgtgtaggaagaatttcttttggaagcattaatgcaattctgggaagcgtggcatta
atactgaattgtcatcatcatgcatcgcgagttgccagaatggcatctgatgagtttcct
tctatgtgtccggcagatggaagagtccgtgggattacgcacaataaaatattgtgggat
tcatccactctgggggcaattctgatgcgcagaactattagcagttga
>espF T3SS secreted effector EspF 4589382:4590128 reverse
atgcttaatggaattagtaacgctgcttctacactagggcggcagcttgtaggtatcgca
agtcgagtgagctctgcggggggaactggattttctgtagcccctcaggccgtgcgtctt
actccggtgaaagttcattcccctttttctccaggctcgtcgaatgttaatgcgagaacg
atttttaatgtgagcagccaggtgacttcatttactccctctcgtccggcaccgccgcca
ccgacaagtggacaggcatccggggcatcccgacctttaccgcccattgcacaggcatta
aaagagcacttggctgcctatgaaaaatcgaaaggtcctgaggctttaggttttaagccc
gcccgtcaggcaccgccgccaccgacaagtggacaggcatccggggcatcccgaccttta
ccgcccattgcacaggcattaaaagagcacttggctgcctatgaaaaatcgaaaggtcct
gaggctttaggttttaagcccgcccgtcaggcaccgccgccaccgacaagtggacaggca
tccggggcatcccgacctttaccgcccattgcacaggcattaaaagagcacttggctgcc
tatgaaaaatcgaaaggtcctgaggctttaggttttaagcccgcccgtcaggcaccaccg
ccaccgacagggcctagtggactaccgccccttgcacaggcattaaaagatcatttagct
gcctatgagcaatcgaagaaagggtaa
>espB T3SS translocator EspB 4591168:4592106 reverse
atgaatactattgataatactcaagtaacgatggttaattccgcttcggagagtacgacc
ggcgcttccagtgcagttgccgcatctgctttatcaattgattcatctctgcttactgat
ggtaaggttgatatttgtaagctgatgctggaaattcaaaaactcctcggcaagatggtg
actctattgcaggattaccaacaaaaacaattggcgcaaagctatcagattcagcaggcc
gtttttgagagccagaataaagctattgaggaaaaaaaagccgcggcaaccgctgctttg
gttggcgggattatttcatcagcattggggatcttaggttcttttgcagcaatgaacaac
gcggctaaaggggctggtgagattgctgaaaaagcaagctctgcatcttcaaaggctgct
ggtgcggcttctgaggttgcaaataaagctctggtcaaggctacggaaagtgttgctgat
gtcgcagaggaggcatccagtgcgatgcagaaagcgatggccacaacaacgaaagcagcc
agccgtgcatctggcgttgcagatgatgttgcgaaagcctctgactttgctgaagatctt
gcagacgccgccgagaagacaagcagaatcaataagttgttgaattccgtagataaactg
accaataccacagcatttgttgccgtgaccagtcttgctgaaggtacgaaaacgttgcca
acaacaatatctgagtccgtcaaatcgactcatgaggttaatgaacaacgtgcgaagtcg
ctggaaaacttccagcaggggaatctggagctgtataaacaagacgttcgcagaacgcag
gatgatatcacgactcgtctgcgtgatataacgtccgctgtccgcgatctccttgaggtc
cagaatcgtatggggcaatcgggtcgcttagctgggtaa
>tir T3SS translocated intimin receptor Tir 4600055:4601731 reverse
atgcctattggtaatcttggtcataatcccaatgtgaataattcaattcctcctgcacct
ccattaccttcacaaaccgacggtgcaggggggcgtggtcagctcattaactctacgggg
ccgttgggatctcgtgcgctatttacgcctgtaaggaattctatggctgattctggcgac
aatcgtgccagtgatgttcctggacttcctgtaaatccgatgcgcctggcggcgtctgag
ataacactgaatgatggatttgaagttcttcatgatcatggtccgctcgatactcttaac
aggcagattggctcttcggtatttcgagttgaaactcaggaagatggtaaacatattgct
gtcggtcagaggaatggtgttgagacctctgttgttttaagtgatcaagagtacgctcgc
ttgcagtccattgatcctgaaggtaaagacaaatttgtatttactggaggccgtggtggt
gctgggcatgctatggtcaccgttgcttcagatatcacggaagcccgccaaaggatactg
gagctgttagagcccaaagggaccggggagtccaaaggtgctggggagtcaaaaggcgtt
ggggagttgagggagtcaaatagcggtgcggaaaacaccacagaaactcagacctcaacc
tcaacttccagccttcgttcagatcctaaactttggttggcgttggggactgttgctaca
ggtctgatagggttggcggcgacgggtattgtacaggcgcttgcattgacgccggagccg
gatagcccaaccacgaccgaccctgatgcagctgcaagtgcaactgaaactgcgacaaga
gatcagttaacgaaagaagcgttccagaacccagataatcaaaaagttaatatcgatgag
ctcggaaatgcgattccgtcaggggtattgaaagatgatgttgttgcgaatatagaagag
caggctaaagcagcaggcgaagaggccaaacagcaagccattgaaaataatgctcaggcg
caaaaaaaatatgatgaacaacaagctaaacgccaggaggagctgaaagtttcatcgggg
gctggctacggtcttagtggcgcattgattcttggtgggggaattggtgttgccgtcacc
gctgcgcttcatcgaaaaaatcagccggtagaacaaacaacaacaacaactactacaact
acaactacaagcgcacgtacggtagagaataagcctgcaaataatacacctgcacagggc
aatgtagatacccctgggtcagaagataccatggagagcagacgtagctcgatggctagc
acctcgtcgactttctttgacacttccagcatagggaccgtgcagaatccgtatgctgat
gttaaaacatcgctgcatgattcgcaggtgccgacttctaattctaatacgtctgttcag
aatatggggaatacagattctgttgtatatagcaccattcaacatcctccccgggatact
actgataacggcgcacggttattaggaaatccaagtgcggggattcaaagcacttatgcg
cgtctggcgctaagtggtggattacgccatgacatgggaggattaacgggggggagtaat
agcgctgtgaatacttcgaataacccaccagcgccgggatcccatcgtttcgtctaa
>map T3SS secreted effector Map 4602155:4602766 reverse
atgtttagtccaatgacaatggcaggcagatcgttagttcaggcgactgcacagacgctt
aaacctgcggttaccagagctgcaatgcaagcgggtacgggagccacgggtatgaggttc
atgcccgtgcagtcgaactttgtgattaatcatggcaaactgactaaccaactcctgcag
gctgtagccaaacaaactcgtaatggcgatacccaacaatggttccagcaggagcagacg
acttatatatccagaacagtaaatagaactctggatgactattgcaggagtaataattcg
gtcattagtaaggagactaaaggtcacatttttagagctgttgaaaatgcgttacagcaa
cctcttgatatgaacggggcacaatcatcaattggtcacttcttgcagtccaataaatac
tttaatcagaaagttgatgagcagtgcggcaaaagagtggatccaataacacgttttaac
acccagacgaagatgatagaacaagtctcacaagaaatatttgaacgcaactttagcggc
ttcaaagtcagtgagataaaagcgattactcagaatgcgattttagagcatgtacaggat
acccgattgtag
>espH T3SS secreted effector EspH 4603613:4604119 reverse
atgtcgttatcaggagcggtattcaagacatttctgacaagtgaacatgcgtcatggaac
aggttcaacagaaggcttcatatacccaatgaagatatcgtagatgaaattcagcttaaa
gcccgaatgcaacaacgccatcatcgggtatatccagaaataggggattccaccattgtc
tcttttagaggcaaagactatgctgttcactttattaaagatggcccaaaagatgattat
gtgtacaaagtacaaagaataacaccggaaaatggatgtttctcaacgctatttagcgtg
ttttctggcggtgtgactaaggctttggaaagaaaattaaatgagagacatataactcca
ctttcttcaacctggtttcctcgtactcccctggaggggatcttagctgaaagaggatta
tcttctttgttacgtcgtgtacagtctaccgaacgtcttgataatagggctatagcaaca
agagcttcctcttatagcgtattatga
>espZ T3SS secreted effector EspZ 4609705:4610004 forward
atggaagcagcaaatttaagtccttctggtgcagtaatgccgctggcgacctcactcagt
ggaaataactcagtggatgagaagacaggagtgattaaaccagaaaatggaacaaatcgc
accgttagagttatagccggattagcacttaccactacggctctggcagctctaggtaca
ggtattgcagcggcatgctcggagacgagcagcacagaatacttagccctgggtattact
tctggcgtactaggtactcttactgcggttggcggtgcattagcgatgaaatatgcctaa
>espG T3SS secreted effector EspG 4621596:4622741 forward
atgataaatggacttaataatgactccgcatctttagttttagatgctgcaatgaaagtt
aattctgggtttaaaaaaagctgggatgagatgtcatgcgctgaaaagttatttaaagta
cttagttttggtttatggaatccaacgtacagtcgtagtgaaagacaatcatttcaagag
ttgttaaccgttttagagcctgtatatccacttcccaatgaattaggcagagtatctgct
cgtttttcagatggttcatccttaagaatttccgtcactaacagcgaacttgttgaagcc
gagattcgcacagcaaataatgaaaagattactgtgctcctggagtcaaacgaacaaaat
aggttattacaatctttacccatcgatcgccacatgccatacattcaggttcatcgtgcc
ttatctgagatggacctgactgatactacctcaatgcgcaatctacttggttttacgtca
aaactatcaacaaccttgattcctcataatgctcaaacagatccgctttccgggcctaca
ccattcagctctatctttatggatacatgtcgaggactcggcaatgcaaagctttcactc
aatggtgttgatatacctgcaaatgcacaaaaattgcttcgcgatgcactaggacttaaa
gacacacattcatcaccaacccggaatgttatagatcatggtatttctcgccatgatgca
gagcaaatagcaagagaaagcagcggcagtgataaacagaaagctgaagttgtggaattt
ttatgccatccagaagcagcaacggccatatgctcggctttctatcaatctttcaatgtg
ccagccttaacgttgacacatgaaaggatctctaaagccagtgaatacaatgcggaaaga
tcattagatacacctaacgcttgcattaacatcagtatctctcaatcatcagatggaaac
atttatgttaccagccatactggggttctgataatggcgccagaagaccgccccaacgag
atgggcatgttgacgaacaggacttcttatgaagtgccgcaaggtgtgaaatgtataatc
gatgaaatggtaagtgcgctacaaccaaggtatgccgcatctgaaacgtacttacaaaac
acttaa
>fimB type 1 fimbriae regulatory protein FimB 5395992:5396594 forward
atgaagaataaggctgataacaaaaaaaggaacttcctgacccatagtgaaatcgaatca
ctccttaaagcagcaaataccgggcctcatgcagcacgtaattattgtctgactttgctt
tgttttattcatggtttccgggcgagtgaaatttgtcgattgaggatttcggatattgat
cttaaggcaaagtgtatatatatccatcgattaaaaaaaggcttttcaacaacgcacccg
ctattgaacaaagaagttcaggctttaaaaaactggttgagtatccgtacttcttatccg
catgctgagagcgagtgggtatttttatcgcgtaaggggaatccgctttctcggcaacaa
ttttaccatattatctcgacttccggtggtaatgccgggttgtcactggagattcatccg
cacatgttacgccattcgtgtggttttgctttggcgaatatgggaatagatacgcgactt
atccaggattatcttgggcatcgcaatattcgtcatactgtctggtatactgccagcaat
gcagggcgtttttacggcatctgggatagagccagaggacgacagcgtcacgctgtttta
tag
>fimE type 1 fimbriae regulatory protein FimE 5397072:5397668 forward
gtgagtaaacgtcgttatcttaccggtaaagaagttcaggccatgatgcaggcggtttgt
tacggggcaacgggagccagagattattgtcttattctgttggcatatcggcatgggatg
cgtattagtgaactgcttgatctgcattatcaggatcttgaccttaatgaaggccgaata
aatattcgccgactgaagaacggattttctaccgttcacccgttacgttttgatgagcgt
gaagctgtggaacgctggaccctagaacgtgctaactggaaaggcgctgaccggaccgac
gccatatttatttctcgccgcgggagtcggctttctcgccagcaggcctatcgcattatt
cgtgatgccggtattgaagctggaaccgtaacgcagactcatcctcatatgttaaggcat
gcttgcggttatgaactggcggagcgtggtgcagatactcgtttaattcaggattatctc
gggcatcgaaatattcgccatactgtacgttataccgccagtaatgctgctcgttttgcc
ggattatgggaaagaaataatctcataaacgaaaaattaaaaagagaagaagtttga
>fimA major type 1 subunit fimbrin 5398133:5398681 forward
atgaaaattaaaactctggcaatcgttgttctgtcggctctgtccctcagttctacagcg
gctctggccgctgccacgacggttaatggtgggaccgttcactttaaaggggaagttgtt
aacgccgcttgcgcagttgatgcaggctctgttgatcaaaccgttcagttaggacaggtt
cgtaccgcatcgctggcacaggacggagcaaccagttctgctgtcggttttaacattcag
ctgaatgattgcgataccaatgttgcatctaaagccgctgttgcctttttaggtacggtg
attgatgcgggtcataccaacgttctggctctgcagagttcagctgcgggtagcgcaaca
aacgttggtgtgcagatcctggacagaacgggtgctgcgctgacgctggatggtgcgaca
ttcagtgagcaaacaaccctgaataacggtactaacaccattccgttccaggcgcgttat
tatgcaatcggcgaggcaaccccgggtgctgctaatgcggatgcgaccttcaaggttcag
tatcaataa
>fimI fimbrial protein involved in type 1 pilus biosynthesis 5398788:5399285 forward
atgtttgctctggccggaaataaatggaataccacgccgcccggcggaaatatgcaattt
cagggcgtcattattgcggaaacttgcctgattgaagccggtgataaacaaatgacggtc
aatatggggcaaatcagcagtaaccggtttcatgcggtaggggaagatagcgcaccggtg
ccttttgttattcatttacgggaatgtagcacggtggtgagtgaacgtgtgggtgtggcg
tttcacggtgtcgcggatggtaaaaatccggatgtgctttccgtgggagaggggccaggg
atagccaccaatattggcgtagcgttgtttgatgatgaaggaaacctcgtaccgattaat
cgtcctccagcaaactggaaacggctttactcaggctctacttcgctacatttcatcgcc
aaatatcgtgctaccgggcgtcgggttactggcggcatcgccaatgcacaggcctggttc
tctttaacctatcagtaa
>fimC periplasmic chaperone 5399322:5400047 forward
gtgagtaataaaaacgtcaatgtaaggaaatcgcaggaaataacattctgcttgctggca
ggtatcctgatgttcatggcaatgatggttgccggacgcgctgaagcgggagtggcctta
ggtgcgactcgcataatttatccggcagggcaaaaacaagtgcaacttgccgtgacaaat
aatgatgaaaatagtacctatttaattcaatcatgggtggaaaatgccgatggtgtaaag
gatggtcgttttatcgtgacgcctcctctgtttgcgatgaagggaaaaaaagagaatacc
ttacgtattcttgatgcaacaaataaccaattgccacaggaccgggaaagtttattctgg
atgaacgttaaagcgattccgtcaatggataaatcaaaattgactgagaatacgctacag
ctcgcaattatcagccgcattaaactgtactatcgtccggctaaattagcgttgccaccc
gatcaggccgcagaaaaattaagatttcgtcgtagcgcgaattctctgacgctgattaac
ccgacaccctattacctgacggtaacagagttgaatgccggagcccgggttcttgaaaat
gccttggtgcctccaatgggcgaaagcacggttaaattgccttctgatgcgggaagcaat
attacttaccgaacaataaatgattatggtgcacttacccccaaaatgacgggcgtaatg
gaataa
>fimD outer membrane usher protein FimD 5400114:5402750 forward
atgtcatatctgaatttaagactttaccagcgaaacacacaatgcttgcatattcgtaag
catcgtttggctggtttttttgtccggctctttgtcgcctgtgcttttgccgtacaggca
cctttgtcatctgccgaactctattttaatccgcgctttttagcggatgatccccaggct
gtggccgatttatcgcgttttgaaaatgggcaagaattaccgccagggacgtatcgcgtc
gatatctatttgaataatggttatatggcaacgcgtgatgtcacatttaatacgggcgac
agtgaacaagggattgttccctgcctgacacgcgcgcaactcgccagtatggggctgaat
acggcttctgtcgccggtatgaatctgctggcggatgatgcctgtgtgccattaaccaca
atggtccaggacgctactgcgcatttagatgttggtcagcagcgactgaacctgacgatc
cctcaggcatttatgagtaatcgcgcgcgtggttatattcctcctgagttatgggatccc
ggtattaatgccggattgctcaattataatttcagcggaaatagtgtacagaatcggatt
gggggtaacagccattatgcatatttaaacctacagagtgggttaaatattggtgcgtgg
cgtttacgcgacaataccacctggagttataacagtagcgacagatcatcaggtagcaaa
aataaatggcagcatatcaatacctggcttgagcgagacataataccgttacgttcccgg
ctgacgctgggtgatggttatactcagggtgatattttcgatggtattaactttcgcggc
gcacaattggcctcagatgacaatatgttacccgatagccaaagaggatttgccccggtg
atccacggtattgctcgtggtactgcacaggtcactattaaacaaaatgggtatgacatt
tataatagtacggtgccgccggggccttttaccatcaacgatatctatgccgcaggtaat
agtggtgacttgcaggtaacgattaaagaggctgacggcagcacgcagatttttaccgta
ccctattcgtcagtcccgcttttgcaacgtgaagggcatactcgttattccattacggca
ggagaataccgtagtggaaatgcgcaacaggaaaaaccccgctttttccaaagtacatta
ctccacggccttccagctggctggacaatatatggtggaacgcaactggcagatcgttat
cgtgcttttaattttggtatcgggaaaaatatgggggcactgggcgctctgtctgtggat
atgactcaggctaattccacacttcccgatgacagtcagcatgacggacaatcggtgcgt
tttctctataacaaatcgctcaatgagtcaggcacgaatattcagttagtgggttaccgt
tattcgaccagcggatattttaatttcgctgatacaacatacagtcgaatgaatggctac
aacatcgaaacacaggacggagttattcaggttaagccgaaattcaccgactattacaac
ctcgcttataacaaacgcgggaaattacaactcaccgttactcagcaactcgggcgctca
tcaacactgtatttgagtggtagccatcaaacttattggggaacgagtaatgtcgatgag
caattccaggctggattaaatactgcgttcgaagatatcaactggacgctcagctatagc
ctgacgaaaaacgcctggcaaaaaggacgtgatcagatgttagcgcgtaacgtcaatatt
cctttcagccactggctgcgttctgacagtaaatctcagtggcgacatgccagtgccagc
tacagcatgtcacacgatctcaacggtcggatgaccaatctggctggtgtatacggtacg
ttgctggaagacaacaacctcagctatagcgtgcaaaccggctatgccgggggaggcgat
ggtaatagcggaagcacaggctacgccacgctgaattatcgcggtggttacggcaatgcc
aatatcggttacagccatagcgatgatattaagcagctctattacggagtcagcggtggg
gtactggctcatgccaatggcgtaacgctggggcagccgttaaacgatacggtggtgctt
gttaaagcgcctggcgcaaaagatgcaaaagtcgaaaaccagacgggggtgcgtaccgac
tggcgcggttatgccgtgctgccttatgccactgaatatcgggaaaatagagtggcgctg
gataccaataccctggctgataacgtcgatttagataacgcggtcgctaacgttgttccc
actcgtggggcgatcgtgcgagcagagtttaaagcgcgcgttgggataaaactgctcatg
acgctaacccacaataataagccgctgccgtttggggcgatggtgacatcagagagtagc
cagagtagcggcattgttgcggataatggtcaggtttacctcagcggaatgcctctagcg
ggaaaagttcaggtgaaatggggagaagaggaaaatgctcattgtgtcgccaattatcaa
ctgccaccagagagtcagcagcagttattaacccagctatcagctgaatgtcgttaa
>fimF minor component of type 1 fimbriae 5402760:5403290 forward
atgagaaacaaacctttttatcttctgtgcgcttttttgtggctggcagtgagtcacgct
ttggctgcggatagcacgattactatccgcggctatgtcagagataacggctgtagtgtg
gccgctgaatcaaccaattttactgttgatctgatggaaaacgcggcgaagcaatttaac
aacattggcgcgacgactcctgtcgttccatttcgtattttgctgtcaccctgtggtaac
gccgtttctgccgtaaaagttgggtttaccggcgttgcagatagccacaatgccaacctg
cttgcacttgaaaatacggtgtcagcggcttcgggactgggaatacagcttctgaatgag
cagcaaaatcagataccccttaatgctccatcgtccgcgatttcgtggacgaccctgacg
ccgggtaaaccaaatacgttgaatttttacgcccggctaatggcgacacaggtgcctgtc
actgcggggcatatcaatgccacggctaccttcactcttgaatatcagtaa
>fimG minor component of type 1 fimbriae 5403303:5403806 forward
atgaaatggcgcaaacgtgggtatttattggcggcaatattggcgctcgcaagtgcgacg
atacaggcagccgatgtcaccatcacggtgaacggtaaggtcgtcgccaaaccgtgcaca
gtttccaccaccaatgccacggttgatctcggcgatctttattctttcagtctgatgtct
gccggggcggcatcggcctggcatgatgttgcgcttgagttgactaattgtccggtggga
acgtcaagggtcactgccagcttcagcggggcagccgacagtaccggatattataaaaac
caggggaccgcgcaaaacatccagttagagctacaggatgacagtggcaacacattgaat
actggcgcaaccaaaacagttcaggtggatgattcctcacaatcagcgcacttcccgtta
caggtcagagcattgacggtaaatggcggagccactcagggaaccattcaggcagtgatt
agcatcacctatacctacagctga
>fimH minor component of type 1 fimbriae 5403826:5404728 forward
atgaaacgagttattaccctgtttgctgtactgctgatgggctggtcggtaaatgcctgg
tcattcgcctgtaaaaccgccaatggtaccgctatccctattggcggtggcagcgctaat
gtttatgtaaaccttgcgcctgccgtgaatgtggggcaaaacctggtcgtagatctttcg
acgcaaatcttttgccataacgattatccggaaaccattacagactatgtcacactgcaa
cgaggctcggcttatggcggcgtgttatctaatttttccgggaccgtaaaatatagtggc
agtagctatccatttccgaccaccagcgaaacgccgcgggttgtttataattcgagaacg
gataagccgtggccggtggcgctttatttgacgcctgtgagcagtgcgggcggggtggcg
attaaagctggctcattaattgccgtgcttattttgcgacagaccaaaaactataacagc
gatgatttccagtttgtgtggaatatttacgccaataatgatgtggtagtgcctactggc
ggctgcgatgtttctgctcgtgatgtcaccgttactctgccggactaccctggttcagtg
ccaattcctcttaccgtttattgtgcgaaaagccaaaacctggggtattacctctccggc
acaaccgcagatgcgggcaactcgattttcaccaataccgcgtcgttttcaccagcgcag
ggcgtcggcgtacagttgacgcgcaacggtacgattattccagcgaataacacggtatcg
ttaggagcagtaggaacttcggcggtaagtctgggattaacggcaaattacgcacgtacc
ggcgggcaggtgactgcagggaatgtgcaatcgattattggcgtgacttttgtttatcaa
taa
markers.fasta.txt · Last modified: 2019/11/11 19:42 by hyjeong