User Tools

Site Tools


markers.fasta

Differences

This shows you the differences between two versions of the page.

Link to this comparison view

markers.fasta [2019/11/11 19:42] (current)
hyjeong created
Line 1: Line 1:
 +  >ecpE ECP production pilus chaperone 336904:​337614 reverse 
 +  atgttcaggcgacgtggcgtaacattaactaaggccctgctgacagcggtctgtatgctg 
 +  gcggcacctttgacacaggcgatttcggtcggcaatctgactttttcactgccgtccgag 
 +  actgactttgtcagcaaacgtgtagtgaataacaacaaaagcgcgcggatataccgtatt 
 +  gccatcagtgctatcgatagcccgggcagcagtgaattacgcacccgaccggtggatggt 
 +  gaactgcttttcgccccccgccagctggcgttgcaggctggtgagagcgagtattttaaa 
 +  ttttactatcatgggccacaggataaccgcgagcgctactaccgggtctcatttcgcgag 
 +  gtccccactcgtaacctgacaaaacgcagccctaccggcggtgaggttagcacggagccg 
 +  gtggtggtgatggataccattctggtagtacgaccacgtcaggttcagtttaaatggtcc 
 +  ttcgatcaggtgaccggaacggtaagtaacaccggcaacacgtggtttaagctactgatt 
 +  aaaccaggatgtgattcgaccgaagaggaaggcgatgcctggtatctacgtccggaagac 
 +  gtggttcatcagcctgagttacgtcagccggggaatcactatctggtctataacgacaaa 
 +  ttcattaagattagcgattcctgtccggctaagcccccttcggcggactga 
 +  >ecpD polymerized tip adhesin of ECP fibers 337583:​339226 reverse 
 +  atgagagttaacctactgatagcgatgataatctttgcgctaatctggccagtaactgcg 
 +  ctcagagcggcagtgagcaaaacaacctgggcggatgcaccggcacgcgagtttgtgttt 
 +  gtcgaaaacaactcagacgacaactttttcgtcactcctggcggggcgctggatccgcgc 
 +  ctgaccggtgccaaccgctggaccggtttaaaatacaatggttcaggaaccatctatcag 
 +  caaagcctcggctacattgataacggttacaacaccggcctttataccaactggaagttt 
 +  gatatgtggctggaaaattcaccagtttcatctcctttaactggcttgcgctgcatcaac 
 +  tggtacgctgggtgtaatatgaccaccagtcttatcctgccgcaaaccaccgacaccagt 
 +  ggattttatggcgcgacggtgaccagcggcggcgcgaagtggatgcacggcatgttgtca 
 +  gacgcgttttaccagtatctgcaacaaatgcccgtcggcagcagctttacaatgaccatc 
 +  aatgcctgccagacctctgtgaactatgacgccagcagcggcgcacgctgtaaggatcag 
 +  gcctccggcaactggtatgttcgcaacgtcacccatacgaaagcagcaaatctacggttg 
 +  ataaatacccactcgctggcggaagtatttatcaacagcgacggagtaccgactctgggc 
 +  gaagggaacgccgactgccggacgcaaaccatcggcagccgttcaggattaagttgtaag 
 +  atggttaactataccctgcaaacaaacggactcagcaacacctcaatccatatattcccg 
 +  gcgatcgccaactcgtcgttagcctcggccgtcggggcgtacgatatgcagttcagtctg 
 +  aatggcagttcatggaaaccggtgagcaatactgcctattactacaccttcaacgagatg 
 +  aagagcgcagactcgatctatgttttcttctcgagcaacttctttaagcagatggtgaac 
 +  cagggaatcagcgatatcaacaccaaagatctattcaactttcgctttcagaacaccaca 
 +  tcaccggagtctggctggtatgaattttctacctccaacacgctgattatcaaaccccgt 
 +  gatttcagcatcagtattatctccgatgaatatactcagacaccgtcgcgggagggatat 
 +  gtcggcagcggcgagtcggcactcgatttcggctatatcgtaaccaccagcggtaaaaca 
 +  gctgccgacgaagtgctgatcaaggtgaccggacccgcgcaggtgattggcgggcgctcc 
 +  tattgtgtcttcagctccgatgacggtaaggcgaaagtaccgttcccggcgacgctttcc 
 +  tttattacccgcaacggagctacaaaaacctacgatgccgggtgcgatgatagctggcgg 
 +  gatatgaccgatgcgctgtggttgaccacaccgtggactgatatctctggcgaagtgggg 
 +  cagatggataagaccacagtcaaattttcgattccaatggataacgccatttctctgcgt 
 +  acggtagatgataacggctggtttggcgaagtcagcgcttcaggagaaattcatgttcag 
 +  gcgacgtggcgtaacattaactaa 
 +  >ecpB ECP production pilus chaperone 341767:​342435 reverse 
 +  atgaaaaagcaccttctgcttctcgctctgctgttatccggaatatctccggcccaggcg 
 +  ctggatgtcggcgatatatcatcgtttatgaacagtgacagcagcacgctgagcaaaacg 
 +  atcaaaaacagtaccgacagtggtcgccttatcaatatccgtctcgaacggctctcttca 
 +  ccgcttgacgacgggcaggttatctcaatggacaagccggacgagttgctactcactccc 
 +  gccagcttgctgctacccgcccaagccagcgaagtgatccgcttcttctataagggacca 
 +  gcagatgaaaaagagcgctactaccgcattgtctggtttgatcaggccctcagtgatgcg 
 +  cagcgcgataatgccaaccgcagcgctgtggccactgcttccgcccgcatcggcaccatt 
 +  ctggtcgtcgccccccgccaggcaaactaccactttcagtacgccaacggcaccctgaca 
 +  aatacaggaaatgcgacgctgcggatcctcgcctacggcccctgcctgaaagccgccaat 
 +  ggtaaagagtgtaaagagaattactacctgatgccgggcaagtcgcgtcgttttacccgc 
 +  gtggacacggcggataacaaaggacgggttgcactttggcagggtgataagttcattccc 
 +  gtgaaatag 
 +  >ecpA ECP pilin 342493:​343080 reverse 
 +  atgaaaaaaaaggttctggcaatagctctggtaacggtgtttaccggcatgggtgtggcg 
 +  caggctgctgacgtaacagctcaggctgtagcgacctggtcagcaacagccaaaaaagac 
 +  accaccagtaagctggttgtgacgccactcggtagcctggcgttccagtatgccgaaggc 
 +  attaaaggttttaactcacagaaaggtctatttgacgtggctatcgagggtgactcaacg 
 +  gctaccgcctttaaactgacctcacgtcttatcaccaacacattaacccagttggatacc 
 +  tcaggttccacactgaatgtgggcgtggattataacggcgcggcagtcgaaaaaactggc 
 +  gataccgtgatgatcgataccgccaacggcgtactgggcggcaaccttagcccgctggca 
 +  aacggttacaatgccagcaatcgtaccaccgcacaggatggtttcactttctccatcatc 
 +  agcggcaccaccaatggtaccaccgcagtaaccgattacagcactctaccggaaggcatc 
 +  tggagcggcgacgttagcgtacagttcgacgcgacctggaccagttaa 
 +  >ecpR transcriptional regulator for the ecp operon 343155:​343697 reverse 
 +  atggaatgtcaaaaccgttctgataaatacatctggtctccccatgacgcctacttctat 
 +  aaaggactatctgaactgattgtggatatcgacagattaatttatctatcgctggagaaa 
 +  atcagaaaagatttcgtgtttatcaatctcaatacggattctttaactgaatttataaac 
 +  cgtgataatgagtggttatccgcggtaaaggggaaacaggtcgtattgattgcggccaga 
 +  aagtcagaagccttagcaaattattggtattacaacagcaatattaggggcgtggtatac 
 +  gctggactgagtcgtgatattagaaaagaactggcctatgtgattaatggcaggttcctg 
 +  agaaaagatattaagaaagataaaatcactgaccgggaaatggaaattatccgcatgacg 
 +  gctcagggaatgctgcctaaatcgattgccagaattgaaaattgtagtgtaaagacagtg 
 +  tatacccatcggcgtaatgcagaggccaagctgtactcaaaattatataagttggttcag 
 +  taa 
 +  >stx2A Shiga toxin 2 subunit A 1267107:​1268066 forward 
 +  atgaagtgtatattatttaaatgggtactgtgcctgttactgggtttttcttcggtatcc 
 +  tattcccgggagtttacgatagacttttcgacccaacaaagttatgtctcttcgttaaat 
 +  agtatacggacagagatatcgacccctcttgaacatatatctcaggggaccacatcggtg 
 +  tctgttattaaccacaccccaccgggcagttattttgctgtggatatacgagggcttgat 
 +  gtctatcaggcgcgttttgaccatcttcgtctgattattgagcaaaataatttatatgtg 
 +  gccgggttcgttaatacggcaacaaatactttctaccgtttttcagattttacacatata 
 +  tcagtgcccggtgtgacaacggtttccatgacaacggacagcagttataccactctgcaa 
 +  cgtgtcgcagcgctggaacgttccggaatgcaaatcagtcgtcactcactggtttcatca 
 +  tatctggcgttaatggagttcagtggtaatacaatgaccagagatgcatccagagcagtt 
 +  ctgcgttttgtcactgtcacagcagaagccttacgcttcaggcagatacagagagaattt 
 +  cgtcaggcactgtctgaaactgctcctgtgtatacgatgacgccgggagacgtggacctc 
 +  actctgaactgggggcgaatcagcaatgtgcttccggagtatcggggagaggatggtgtc 
 +  agagtggggagaatatcctttaataatatatcagcgatactggggactgtggccgttata 
 +  ctgaattgccatcatcagggggcgcgttctgttcgcgccgtgaatgaagagagtcaacca 
 +  gaatgtcagataactggcgacaggcctgttataaaaataaacaatacattatgggaaagt 
 +  aatacagctgcagcgtttctgaacagaaagtcacagtttttatatacaacgggtaaataa 
 +  >stx2B Shiga toxin 2 subunit B 1268078:​1268347 forward 
 +  atgaagaagatgtttatggcggttttatttgcattagcttctgttaatgcaatggcggcg 
 +  gattgtgctaaaggtaaaattgagttttccaagtataatgaggatgacacatttacagtg 
 +  aaggttgacgggaaagaatactggaccagtcgctggaatctgcaaccgttactgcaaagt 
 +  gctcagttgacaggaatgactgtcacaatcaaatccagtacctgtgaatcaggctccgga 
 +  tttgctgaagtgcagtttaataatgactga 
 +  >hlyE hemolysin E 1671107:​1672018 reverse 
 +  atgactgaaatcgttgcagataaaacggtagaggtagttaaaaacgcaatcgaaaccgca 
 +  gatggagcattggatctttataataaatatctcgatcaggtcatcccctggcagaccttt 
 +  gatgaaaccataaaagagttaagtcgctttaaacaggagtattcacaggcagcctccgtt 
 +  ttagttggcaatattaaaaccttactaatggatagccaggataagtattttgaagcaacc 
 +  caaacagtgtatgaatggtgtggtgttgcgacgcaattgctcgcagcgtatattttgcta 
 +  tttgatgagtataatgagaagaaagcatccgcccagaaagacattctcattaaggtactg 
 +  gatgacggcatcacgaagctgaatgaagcgcaaaaatccctgctggtaagctcacaaagt 
 +  ttcaacaacgcttccgggaaactgctggcgttagatagccagttaaccaatgatttttca 
 +  gaaaaaagcagctatttccagtcacaggtagataaaatcaggaaggaagcgtatgccggt 
 +  gccgcagccggtgtcgtcgccggtccatttggtttaatcatttcctattctattgctgcg 
 +  ggcgtagttgaagggaaactgattccagaattgaagaacaagttaaaatctgtgcagagt 
 +  ttctttaccaccctgtctaacacggttaaacaagcgaataaagatatcgatgccgccaaa 
 +  ttgaaattaaccaccgaaatagccgccatcggggagataaaaacggaaactgaaacaacc 
 +  agattctatgttgattatgatgatttaatgctttctttgctaaaagaagcggccaataaa 
 +  atgattaacacctgtaatgagtatcagaaaagacacggtaagaagacactctttgaggta 
 +  cctgaagtctga 
 +  >stx1B Shiga toxin 1 subunit B 2924625:​2924894 reverse 
 +  atgaaaaaaacattattaatagctgcatcgctttcatttttttcagcaagtgcgctggcg 
 +  acgcctgattgtgtaactggaaaggtggagtatacaaaatataatgatgacgataccttt 
 +  acagttaaagtgggtgataaagaattatttaccaacagatggaatcttcagtctcttctt 
 +  ctcagtgcgcaaattacggggatgactgtaaccattaaaactaatgcctgtcataatgga 
 +  gggggattcagcgaagttatttttcgttga 
 +  >stx1A Shiga toxin 1 subunit A 2924904:​2925851 reverse 
 +  atgaaaataattatttttagagtgctaacttttttctttgttatcttttcagttaatgtg 
 +  gttgcgaaggaatttaccttagacttctcgactgcaaagacgtatgtagattcgctgaat 
 +  gtcattcgctctgcaataggtactccattacagactatttcatcaggaggtacgtcttta 
 +  ctgatgattgatagtggcacaggggataatttgtttgcagttgatgtcagagggatagat 
 +  ccagaggaagggcggtttaataatctacggcttattgttgaacgaaataatttatatgtg 
 +  acaggatttgttaacaggacaaataatgttttttatcgctttgctgatttttcacatgtt 
 +  acctttccaggtacaacagcggttacattgtctggtgacagtagctataccacgttacag 
 +  cgtgttgcagggatcagtcgtacggggatgcagataaatcgccattcgttgactacttct 
 +  tatctggatttaatgtcgcatagtggaacctcactgacgcagtctgtggcaagagcgatg 
 +  ttacggtttgttactgtgacagctgaagctttacgttttcggcaaatacagaggggattt 
 +  cgtacaacactggatgatctcagtgggcgttcttatgtaatgactgctgaagatgttgat 
 +  cttacattgaactggggaaggttgagtagtgtcctgcctgattatcatggacaagactct 
 +  gttcgtgtaggaagaatttcttttggaagcattaatgcaattctgggaagcgtggcatta 
 +  atactgaattgtcatcatcatgcatcgcgagttgccagaatggcatctgatgagtttcct 
 +  tctatgtgtccggcagatggaagagtccgtgggattacgcacaataaaatattgtgggat 
 +  tcatccactctgggggcaattctgatgcgcagaactattagcagttga 
 +  >espF T3SS secreted effector EspF 4589382:​4590128 reverse 
 +  atgcttaatggaattagtaacgctgcttctacactagggcggcagcttgtaggtatcgca 
 +  agtcgagtgagctctgcggggggaactggattttctgtagcccctcaggccgtgcgtctt 
 +  actccggtgaaagttcattcccctttttctccaggctcgtcgaatgttaatgcgagaacg 
 +  atttttaatgtgagcagccaggtgacttcatttactccctctcgtccggcaccgccgcca 
 +  ccgacaagtggacaggcatccggggcatcccgacctttaccgcccattgcacaggcatta 
 +  aaagagcacttggctgcctatgaaaaatcgaaaggtcctgaggctttaggttttaagccc 
 +  gcccgtcaggcaccgccgccaccgacaagtggacaggcatccggggcatcccgaccttta 
 +  ccgcccattgcacaggcattaaaagagcacttggctgcctatgaaaaatcgaaaggtcct 
 +  gaggctttaggttttaagcccgcccgtcaggcaccgccgccaccgacaagtggacaggca 
 +  tccggggcatcccgacctttaccgcccattgcacaggcattaaaagagcacttggctgcc 
 +  tatgaaaaatcgaaaggtcctgaggctttaggttttaagcccgcccgtcaggcaccaccg 
 +  ccaccgacagggcctagtggactaccgccccttgcacaggcattaaaagatcatttagct 
 +  gcctatgagcaatcgaagaaagggtaa 
 +  >espB T3SS translocator EspB 4591168:​4592106 reverse 
 +  atgaatactattgataatactcaagtaacgatggttaattccgcttcggagagtacgacc 
 +  ggcgcttccagtgcagttgccgcatctgctttatcaattgattcatctctgcttactgat 
 +  ggtaaggttgatatttgtaagctgatgctggaaattcaaaaactcctcggcaagatggtg 
 +  actctattgcaggattaccaacaaaaacaattggcgcaaagctatcagattcagcaggcc 
 +  gtttttgagagccagaataaagctattgaggaaaaaaaagccgcggcaaccgctgctttg 
 +  gttggcgggattatttcatcagcattggggatcttaggttcttttgcagcaatgaacaac 
 +  gcggctaaaggggctggtgagattgctgaaaaagcaagctctgcatcttcaaaggctgct 
 +  ggtgcggcttctgaggttgcaaataaagctctggtcaaggctacggaaagtgttgctgat 
 +  gtcgcagaggaggcatccagtgcgatgcagaaagcgatggccacaacaacgaaagcagcc 
 +  agccgtgcatctggcgttgcagatgatgttgcgaaagcctctgactttgctgaagatctt 
 +  gcagacgccgccgagaagacaagcagaatcaataagttgttgaattccgtagataaactg 
 +  accaataccacagcatttgttgccgtgaccagtcttgctgaaggtacgaaaacgttgcca 
 +  acaacaatatctgagtccgtcaaatcgactcatgaggttaatgaacaacgtgcgaagtcg 
 +  ctggaaaacttccagcaggggaatctggagctgtataaacaagacgttcgcagaacgcag 
 +  gatgatatcacgactcgtctgcgtgatataacgtccgctgtccgcgatctccttgaggtc 
 +  cagaatcgtatggggcaatcgggtcgcttagctgggtaa 
 +  >tir T3SS translocated intimin receptor Tir 4600055:​4601731 reverse 
 +  atgcctattggtaatcttggtcataatcccaatgtgaataattcaattcctcctgcacct 
 +  ccattaccttcacaaaccgacggtgcaggggggcgtggtcagctcattaactctacgggg 
 +  ccgttgggatctcgtgcgctatttacgcctgtaaggaattctatggctgattctggcgac 
 +  aatcgtgccagtgatgttcctggacttcctgtaaatccgatgcgcctggcggcgtctgag 
 +  ataacactgaatgatggatttgaagttcttcatgatcatggtccgctcgatactcttaac 
 +  aggcagattggctcttcggtatttcgagttgaaactcaggaagatggtaaacatattgct 
 +  gtcggtcagaggaatggtgttgagacctctgttgttttaagtgatcaagagtacgctcgc 
 +  ttgcagtccattgatcctgaaggtaaagacaaatttgtatttactggaggccgtggtggt 
 +  gctgggcatgctatggtcaccgttgcttcagatatcacggaagcccgccaaaggatactg 
 +  gagctgttagagcccaaagggaccggggagtccaaaggtgctggggagtcaaaaggcgtt 
 +  ggggagttgagggagtcaaatagcggtgcggaaaacaccacagaaactcagacctcaacc 
 +  tcaacttccagccttcgttcagatcctaaactttggttggcgttggggactgttgctaca 
 +  ggtctgatagggttggcggcgacgggtattgtacaggcgcttgcattgacgccggagccg 
 +  gatagcccaaccacgaccgaccctgatgcagctgcaagtgcaactgaaactgcgacaaga 
 +  gatcagttaacgaaagaagcgttccagaacccagataatcaaaaagttaatatcgatgag 
 +  ctcggaaatgcgattccgtcaggggtattgaaagatgatgttgttgcgaatatagaagag 
 +  caggctaaagcagcaggcgaagaggccaaacagcaagccattgaaaataatgctcaggcg 
 +  caaaaaaaatatgatgaacaacaagctaaacgccaggaggagctgaaagtttcatcgggg 
 +  gctggctacggtcttagtggcgcattgattcttggtgggggaattggtgttgccgtcacc 
 +  gctgcgcttcatcgaaaaaatcagccggtagaacaaacaacaacaacaactactacaact 
 +  acaactacaagcgcacgtacggtagagaataagcctgcaaataatacacctgcacagggc 
 +  aatgtagatacccctgggtcagaagataccatggagagcagacgtagctcgatggctagc 
 +  acctcgtcgactttctttgacacttccagcatagggaccgtgcagaatccgtatgctgat 
 +  gttaaaacatcgctgcatgattcgcaggtgccgacttctaattctaatacgtctgttcag 
 +  aatatggggaatacagattctgttgtatatagcaccattcaacatcctccccgggatact 
 +  actgataacggcgcacggttattaggaaatccaagtgcggggattcaaagcacttatgcg 
 +  cgtctggcgctaagtggtggattacgccatgacatgggaggattaacgggggggagtaat 
 +  agcgctgtgaatacttcgaataacccaccagcgccgggatcccatcgtttcgtctaa 
 +  >map T3SS secreted effector Map 4602155:​4602766 reverse 
 +  atgtttagtccaatgacaatggcaggcagatcgttagttcaggcgactgcacagacgctt 
 +  aaacctgcggttaccagagctgcaatgcaagcgggtacgggagccacgggtatgaggttc 
 +  atgcccgtgcagtcgaactttgtgattaatcatggcaaactgactaaccaactcctgcag 
 +  gctgtagccaaacaaactcgtaatggcgatacccaacaatggttccagcaggagcagacg 
 +  acttatatatccagaacagtaaatagaactctggatgactattgcaggagtaataattcg 
 +  gtcattagtaaggagactaaaggtcacatttttagagctgttgaaaatgcgttacagcaa 
 +  cctcttgatatgaacggggcacaatcatcaattggtcacttcttgcagtccaataaatac 
 +  tttaatcagaaagttgatgagcagtgcggcaaaagagtggatccaataacacgttttaac 
 +  acccagacgaagatgatagaacaagtctcacaagaaatatttgaacgcaactttagcggc 
 +  ttcaaagtcagtgagataaaagcgattactcagaatgcgattttagagcatgtacaggat 
 +  acccgattgtag 
 +  >espH T3SS secreted effector EspH 4603613:​4604119 reverse 
 +  atgtcgttatcaggagcggtattcaagacatttctgacaagtgaacatgcgtcatggaac 
 +  aggttcaacagaaggcttcatatacccaatgaagatatcgtagatgaaattcagcttaaa 
 +  gcccgaatgcaacaacgccatcatcgggtatatccagaaataggggattccaccattgtc 
 +  tcttttagaggcaaagactatgctgttcactttattaaagatggcccaaaagatgattat 
 +  gtgtacaaagtacaaagaataacaccggaaaatggatgtttctcaacgctatttagcgtg 
 +  ttttctggcggtgtgactaaggctttggaaagaaaattaaatgagagacatataactcca 
 +  ctttcttcaacctggtttcctcgtactcccctggaggggatcttagctgaaagaggatta 
 +  tcttctttgttacgtcgtgtacagtctaccgaacgtcttgataatagggctatagcaaca 
 +  agagcttcctcttatagcgtattatga 
 +  >espZ T3SS secreted effector EspZ 4609705:​4610004 forward 
 +  atggaagcagcaaatttaagtccttctggtgcagtaatgccgctggcgacctcactcagt 
 +  ggaaataactcagtggatgagaagacaggagtgattaaaccagaaaatggaacaaatcgc 
 +  accgttagagttatagccggattagcacttaccactacggctctggcagctctaggtaca 
 +  ggtattgcagcggcatgctcggagacgagcagcacagaatacttagccctgggtattact 
 +  tctggcgtactaggtactcttactgcggttggcggtgcattagcgatgaaatatgcctaa 
 +  >espG T3SS secreted effector EspG 4621596:​4622741 forward 
 +  atgataaatggacttaataatgactccgcatctttagttttagatgctgcaatgaaagtt 
 +  aattctgggtttaaaaaaagctgggatgagatgtcatgcgctgaaaagttatttaaagta 
 +  cttagttttggtttatggaatccaacgtacagtcgtagtgaaagacaatcatttcaagag 
 +  ttgttaaccgttttagagcctgtatatccacttcccaatgaattaggcagagtatctgct 
 +  cgtttttcagatggttcatccttaagaatttccgtcactaacagcgaacttgttgaagcc 
 +  gagattcgcacagcaaataatgaaaagattactgtgctcctggagtcaaacgaacaaaat 
 +  aggttattacaatctttacccatcgatcgccacatgccatacattcaggttcatcgtgcc 
 +  ttatctgagatggacctgactgatactacctcaatgcgcaatctacttggttttacgtca 
 +  aaactatcaacaaccttgattcctcataatgctcaaacagatccgctttccgggcctaca 
 +  ccattcagctctatctttatggatacatgtcgaggactcggcaatgcaaagctttcactc 
 +  aatggtgttgatatacctgcaaatgcacaaaaattgcttcgcgatgcactaggacttaaa 
 +  gacacacattcatcaccaacccggaatgttatagatcatggtatttctcgccatgatgca 
 +  gagcaaatagcaagagaaagcagcggcagtgataaacagaaagctgaagttgtggaattt 
 +  ttatgccatccagaagcagcaacggccatatgctcggctttctatcaatctttcaatgtg 
 +  ccagccttaacgttgacacatgaaaggatctctaaagccagtgaatacaatgcggaaaga 
 +  tcattagatacacctaacgcttgcattaacatcagtatctctcaatcatcagatggaaac 
 +  atttatgttaccagccatactggggttctgataatggcgccagaagaccgccccaacgag 
 +  atgggcatgttgacgaacaggacttcttatgaagtgccgcaaggtgtgaaatgtataatc 
 +  gatgaaatggtaagtgcgctacaaccaaggtatgccgcatctgaaacgtacttacaaaac 
 +  acttaa 
 +  >fimB type 1 fimbriae regulatory protein FimB 5395992:​5396594 forward 
 +  atgaagaataaggctgataacaaaaaaaggaacttcctgacccatagtgaaatcgaatca 
 +  ctccttaaagcagcaaataccgggcctcatgcagcacgtaattattgtctgactttgctt 
 +  tgttttattcatggtttccgggcgagtgaaatttgtcgattgaggatttcggatattgat 
 +  cttaaggcaaagtgtatatatatccatcgattaaaaaaaggcttttcaacaacgcacccg 
 +  ctattgaacaaagaagttcaggctttaaaaaactggttgagtatccgtacttcttatccg 
 +  catgctgagagcgagtgggtatttttatcgcgtaaggggaatccgctttctcggcaacaa 
 +  ttttaccatattatctcgacttccggtggtaatgccgggttgtcactggagattcatccg 
 +  cacatgttacgccattcgtgtggttttgctttggcgaatatgggaatagatacgcgactt 
 +  atccaggattatcttgggcatcgcaatattcgtcatactgtctggtatactgccagcaat 
 +  gcagggcgtttttacggcatctgggatagagccagaggacgacagcgtcacgctgtttta 
 +  tag 
 +  >fimE type 1 fimbriae regulatory protein FimE 5397072:​5397668 forward 
 +  gtgagtaaacgtcgttatcttaccggtaaagaagttcaggccatgatgcaggcggtttgt 
 +  tacggggcaacgggagccagagattattgtcttattctgttggcatatcggcatgggatg 
 +  cgtattagtgaactgcttgatctgcattatcaggatcttgaccttaatgaaggccgaata 
 +  aatattcgccgactgaagaacggattttctaccgttcacccgttacgttttgatgagcgt 
 +  gaagctgtggaacgctggaccctagaacgtgctaactggaaaggcgctgaccggaccgac 
 +  gccatatttatttctcgccgcgggagtcggctttctcgccagcaggcctatcgcattatt 
 +  cgtgatgccggtattgaagctggaaccgtaacgcagactcatcctcatatgttaaggcat 
 +  gcttgcggttatgaactggcggagcgtggtgcagatactcgtttaattcaggattatctc 
 +  gggcatcgaaatattcgccatactgtacgttataccgccagtaatgctgctcgttttgcc 
 +  ggattatgggaaagaaataatctcataaacgaaaaattaaaaagagaagaagtttga 
 +  >fimA major type 1 subunit fimbrin 5398133:​5398681 forward 
 +  atgaaaattaaaactctggcaatcgttgttctgtcggctctgtccctcagttctacagcg 
 +  gctctggccgctgccacgacggttaatggtgggaccgttcactttaaaggggaagttgtt 
 +  aacgccgcttgcgcagttgatgcaggctctgttgatcaaaccgttcagttaggacaggtt 
 +  cgtaccgcatcgctggcacaggacggagcaaccagttctgctgtcggttttaacattcag 
 +  ctgaatgattgcgataccaatgttgcatctaaagccgctgttgcctttttaggtacggtg 
 +  attgatgcgggtcataccaacgttctggctctgcagagttcagctgcgggtagcgcaaca 
 +  aacgttggtgtgcagatcctggacagaacgggtgctgcgctgacgctggatggtgcgaca 
 +  ttcagtgagcaaacaaccctgaataacggtactaacaccattccgttccaggcgcgttat 
 +  tatgcaatcggcgaggcaaccccgggtgctgctaatgcggatgcgaccttcaaggttcag 
 +  tatcaataa 
 +  >fimI fimbrial protein involved in type 1 pilus biosynthesis 5398788:​5399285 forward 
 +  atgtttgctctggccggaaataaatggaataccacgccgcccggcggaaatatgcaattt 
 +  cagggcgtcattattgcggaaacttgcctgattgaagccggtgataaacaaatgacggtc 
 +  aatatggggcaaatcagcagtaaccggtttcatgcggtaggggaagatagcgcaccggtg 
 +  ccttttgttattcatttacgggaatgtagcacggtggtgagtgaacgtgtgggtgtggcg 
 +  tttcacggtgtcgcggatggtaaaaatccggatgtgctttccgtgggagaggggccaggg 
 +  atagccaccaatattggcgtagcgttgtttgatgatgaaggaaacctcgtaccgattaat 
 +  cgtcctccagcaaactggaaacggctttactcaggctctacttcgctacatttcatcgcc 
 +  aaatatcgtgctaccgggcgtcgggttactggcggcatcgccaatgcacaggcctggttc 
 +  tctttaacctatcagtaa 
 +  >fimC periplasmic chaperone 5399322:​5400047 forward 
 +  gtgagtaataaaaacgtcaatgtaaggaaatcgcaggaaataacattctgcttgctggca 
 +  ggtatcctgatgttcatggcaatgatggttgccggacgcgctgaagcgggagtggcctta 
 +  ggtgcgactcgcataatttatccggcagggcaaaaacaagtgcaacttgccgtgacaaat 
 +  aatgatgaaaatagtacctatttaattcaatcatgggtggaaaatgccgatggtgtaaag 
 +  gatggtcgttttatcgtgacgcctcctctgtttgcgatgaagggaaaaaaagagaatacc 
 +  ttacgtattcttgatgcaacaaataaccaattgccacaggaccgggaaagtttattctgg 
 +  atgaacgttaaagcgattccgtcaatggataaatcaaaattgactgagaatacgctacag 
 +  ctcgcaattatcagccgcattaaactgtactatcgtccggctaaattagcgttgccaccc 
 +  gatcaggccgcagaaaaattaagatttcgtcgtagcgcgaattctctgacgctgattaac 
 +  ccgacaccctattacctgacggtaacagagttgaatgccggagcccgggttcttgaaaat 
 +  gccttggtgcctccaatgggcgaaagcacggttaaattgccttctgatgcgggaagcaat 
 +  attacttaccgaacaataaatgattatggtgcacttacccccaaaatgacgggcgtaatg 
 +  gaataa 
 +  >fimD outer membrane usher protein FimD 5400114:​5402750 forward 
 +  atgtcatatctgaatttaagactttaccagcgaaacacacaatgcttgcatattcgtaag 
 +  catcgtttggctggtttttttgtccggctctttgtcgcctgtgcttttgccgtacaggca 
 +  cctttgtcatctgccgaactctattttaatccgcgctttttagcggatgatccccaggct 
 +  gtggccgatttatcgcgttttgaaaatgggcaagaattaccgccagggacgtatcgcgtc 
 +  gatatctatttgaataatggttatatggcaacgcgtgatgtcacatttaatacgggcgac 
 +  agtgaacaagggattgttccctgcctgacacgcgcgcaactcgccagtatggggctgaat 
 +  acggcttctgtcgccggtatgaatctgctggcggatgatgcctgtgtgccattaaccaca 
 +  atggtccaggacgctactgcgcatttagatgttggtcagcagcgactgaacctgacgatc 
 +  cctcaggcatttatgagtaatcgcgcgcgtggttatattcctcctgagttatgggatccc 
 +  ggtattaatgccggattgctcaattataatttcagcggaaatagtgtacagaatcggatt 
 +  gggggtaacagccattatgcatatttaaacctacagagtgggttaaatattggtgcgtgg 
 +  cgtttacgcgacaataccacctggagttataacagtagcgacagatcatcaggtagcaaa 
 +  aataaatggcagcatatcaatacctggcttgagcgagacataataccgttacgttcccgg 
 +  ctgacgctgggtgatggttatactcagggtgatattttcgatggtattaactttcgcggc 
 +  gcacaattggcctcagatgacaatatgttacccgatagccaaagaggatttgccccggtg 
 +  atccacggtattgctcgtggtactgcacaggtcactattaaacaaaatgggtatgacatt 
 +  tataatagtacggtgccgccggggccttttaccatcaacgatatctatgccgcaggtaat 
 +  agtggtgacttgcaggtaacgattaaagaggctgacggcagcacgcagatttttaccgta 
 +  ccctattcgtcagtcccgcttttgcaacgtgaagggcatactcgttattccattacggca 
 +  ggagaataccgtagtggaaatgcgcaacaggaaaaaccccgctttttccaaagtacatta 
 +  ctccacggccttccagctggctggacaatatatggtggaacgcaactggcagatcgttat 
 +  cgtgcttttaattttggtatcgggaaaaatatgggggcactgggcgctctgtctgtggat 
 +  atgactcaggctaattccacacttcccgatgacagtcagcatgacggacaatcggtgcgt 
 +  tttctctataacaaatcgctcaatgagtcaggcacgaatattcagttagtgggttaccgt 
 +  tattcgaccagcggatattttaatttcgctgatacaacatacagtcgaatgaatggctac 
 +  aacatcgaaacacaggacggagttattcaggttaagccgaaattcaccgactattacaac 
 +  ctcgcttataacaaacgcgggaaattacaactcaccgttactcagcaactcgggcgctca 
 +  tcaacactgtatttgagtggtagccatcaaacttattggggaacgagtaatgtcgatgag 
 +  caattccaggctggattaaatactgcgttcgaagatatcaactggacgctcagctatagc 
 +  ctgacgaaaaacgcctggcaaaaaggacgtgatcagatgttagcgcgtaacgtcaatatt 
 +  cctttcagccactggctgcgttctgacagtaaatctcagtggcgacatgccagtgccagc 
 +  tacagcatgtcacacgatctcaacggtcggatgaccaatctggctggtgtatacggtacg 
 +  ttgctggaagacaacaacctcagctatagcgtgcaaaccggctatgccgggggaggcgat 
 +  ggtaatagcggaagcacaggctacgccacgctgaattatcgcggtggttacggcaatgcc 
 +  aatatcggttacagccatagcgatgatattaagcagctctattacggagtcagcggtggg 
 +  gtactggctcatgccaatggcgtaacgctggggcagccgttaaacgatacggtggtgctt 
 +  gttaaagcgcctggcgcaaaagatgcaaaagtcgaaaaccagacgggggtgcgtaccgac 
 +  tggcgcggttatgccgtgctgccttatgccactgaatatcgggaaaatagagtggcgctg 
 +  gataccaataccctggctgataacgtcgatttagataacgcggtcgctaacgttgttccc 
 +  actcgtggggcgatcgtgcgagcagagtttaaagcgcgcgttgggataaaactgctcatg 
 +  acgctaacccacaataataagccgctgccgtttggggcgatggtgacatcagagagtagc 
 +  cagagtagcggcattgttgcggataatggtcaggtttacctcagcggaatgcctctagcg 
 +  ggaaaagttcaggtgaaatggggagaagaggaaaatgctcattgtgtcgccaattatcaa 
 +  ctgccaccagagagtcagcagcagttattaacccagctatcagctgaatgtcgttaa 
 +  >fimF minor component of type 1 fimbriae 5402760:​5403290 forward 
 +  atgagaaacaaacctttttatcttctgtgcgcttttttgtggctggcagtgagtcacgct 
 +  ttggctgcggatagcacgattactatccgcggctatgtcagagataacggctgtagtgtg 
 +  gccgctgaatcaaccaattttactgttgatctgatggaaaacgcggcgaagcaatttaac 
 +  aacattggcgcgacgactcctgtcgttccatttcgtattttgctgtcaccctgtggtaac 
 +  gccgtttctgccgtaaaagttgggtttaccggcgttgcagatagccacaatgccaacctg 
 +  cttgcacttgaaaatacggtgtcagcggcttcgggactgggaatacagcttctgaatgag 
 +  cagcaaaatcagataccccttaatgctccatcgtccgcgatttcgtggacgaccctgacg 
 +  ccgggtaaaccaaatacgttgaatttttacgcccggctaatggcgacacaggtgcctgtc 
 +  actgcggggcatatcaatgccacggctaccttcactcttgaatatcagtaa 
 +  >fimG minor component of type 1 fimbriae 5403303:​5403806 forward 
 +  atgaaatggcgcaaacgtgggtatttattggcggcaatattggcgctcgcaagtgcgacg 
 +  atacaggcagccgatgtcaccatcacggtgaacggtaaggtcgtcgccaaaccgtgcaca 
 +  gtttccaccaccaatgccacggttgatctcggcgatctttattctttcagtctgatgtct 
 +  gccggggcggcatcggcctggcatgatgttgcgcttgagttgactaattgtccggtggga 
 +  acgtcaagggtcactgccagcttcagcggggcagccgacagtaccggatattataaaaac 
 +  caggggaccgcgcaaaacatccagttagagctacaggatgacagtggcaacacattgaat 
 +  actggcgcaaccaaaacagttcaggtggatgattcctcacaatcagcgcacttcccgtta 
 +  caggtcagagcattgacggtaaatggcggagccactcagggaaccattcaggcagtgatt 
 +  agcatcacctatacctacagctga 
 +  >fimH minor component of type 1 fimbriae 5403826:​5404728 forward 
 +  atgaaacgagttattaccctgtttgctgtactgctgatgggctggtcggtaaatgcctgg 
 +  tcattcgcctgtaaaaccgccaatggtaccgctatccctattggcggtggcagcgctaat 
 +  gtttatgtaaaccttgcgcctgccgtgaatgtggggcaaaacctggtcgtagatctttcg 
 +  acgcaaatcttttgccataacgattatccggaaaccattacagactatgtcacactgcaa 
 +  cgaggctcggcttatggcggcgtgttatctaatttttccgggaccgtaaaatatagtggc 
 +  agtagctatccatttccgaccaccagcgaaacgccgcgggttgtttataattcgagaacg 
 +  gataagccgtggccggtggcgctttatttgacgcctgtgagcagtgcgggcggggtggcg 
 +  attaaagctggctcattaattgccgtgcttattttgcgacagaccaaaaactataacagc 
 +  gatgatttccagtttgtgtggaatatttacgccaataatgatgtggtagtgcctactggc 
 +  ggctgcgatgtttctgctcgtgatgtcaccgttactctgccggactaccctggttcagtg 
 +  ccaattcctcttaccgtttattgtgcgaaaagccaaaacctggggtattacctctccggc 
 +  acaaccgcagatgcgggcaactcgattttcaccaataccgcgtcgttttcaccagcgcag 
 +  ggcgtcggcgtacagttgacgcgcaacggtacgattattccagcgaataacacggtatcg 
 +  ttaggagcagtaggaacttcggcggtaagtctgggattaacggcaaattacgcacgtacc 
 +  ggcgggcaggtgactgcagggaatgtgcaatcgattattggcgtgacttttgtttatcaa 
 +  taa
markers.fasta.txt · Last modified: 2019/11/11 19:42 by hyjeong